ID: 1185314003_1185314012

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1185314003 1185314012
Species Human (GRCh38) Human (GRCh38)
Location 22:50170963-50170985 22:50170992-50171014
Sequence CCGGCGGCCGGGGCGCGGGGCGC AGGGGGCGTCCGCAGGTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 78, 4: 535} {0: 1, 1: 0, 2: 1, 3: 13, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!