ID: 1185315488_1185315494

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1185315488 1185315494
Species Human (GRCh38) Human (GRCh38)
Location 22:50177218-50177240 22:50177246-50177268
Sequence CCGAGGGCCGCGCGCCCAAGATC GCAGATCCAGTCCAAGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45} {0: 1, 1: 0, 2: 1, 3: 7, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!