ID: 1185325871_1185325881

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1185325871 1185325881
Species Human (GRCh38) Human (GRCh38)
Location 22:50225620-50225642 22:50225648-50225670
Sequence CCCACCCTTCATCTCAACTCCCC CACCCACCCAGGCCACCGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 68, 4: 631} {0: 1, 1: 0, 2: 4, 3: 46, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!