ID: 1185333370_1185333378

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1185333370 1185333378
Species Human (GRCh38) Human (GRCh38)
Location 22:50261374-50261396 22:50261401-50261423
Sequence CCCGCGCTCACCACACCGCGCCG CGCCCGAGCCCACGGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94} {0: 1, 1: 0, 2: 2, 3: 14, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!