ID: 1185340141_1185340149

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185340141 1185340149
Species Human (GRCh38) Human (GRCh38)
Location 22:50287480-50287502 22:50287495-50287517
Sequence CCGCCCAGGTCATAGGGGTCCAG GGGTCCAGGGGACCAATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121} {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!