ID: 1185344704_1185344720

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1185344704 1185344720
Species Human (GRCh38) Human (GRCh38)
Location 22:50306214-50306236 22:50306251-50306273
Sequence CCAGACCTCAGGCCTCCCAGACC TGGGCCCCCCATAGGTACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 95, 4: 902} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!