ID: 1185346154_1185346166

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1185346154 1185346166
Species Human (GRCh38) Human (GRCh38)
Location 22:50311736-50311758 22:50311773-50311795
Sequence CCTGTCCTGGGCAGCCTGTTGGG ACACACAGCGCAGGGGGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 260} {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!