ID: 1185348267_1185348274

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1185348267 1185348274
Species Human (GRCh38) Human (GRCh38)
Location 22:50320034-50320056 22:50320060-50320082
Sequence CCAGTGGGCCCTGCAATGTCTCC GCTGCCTGAAGCCTGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!