ID: 1185363261_1185363268

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1185363261 1185363268
Species Human (GRCh38) Human (GRCh38)
Location 22:50422231-50422253 22:50422248-50422270
Sequence CCATCTGCTTTCCTCATCCACAG CCACAGGACAGAGGGCTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 534} {0: 1, 1: 0, 2: 2, 3: 28, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!