ID: 1185371117_1185371129

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1185371117 1185371129
Species Human (GRCh38) Human (GRCh38)
Location 22:50461412-50461434 22:50461433-50461455
Sequence CCACGGGCACCCAGAACCCCCGA GAGAAAAGGGAGAGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 122} {0: 1, 1: 2, 2: 25, 3: 296, 4: 2496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!