ID: 1185376307_1185376316

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1185376307 1185376316
Species Human (GRCh38) Human (GRCh38)
Location 22:50484091-50484113 22:50484110-50484132
Sequence CCACAGAGCTTGCCCCTCAGTTC GTTCCTACCTCCAAGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 224} {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!