ID: 1185385409_1185385416

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1185385409 1185385416
Species Human (GRCh38) Human (GRCh38)
Location 22:50529545-50529567 22:50529580-50529602
Sequence CCTGATGTCCGCTTCGCTCAGGC GCTTCATGCGGATCAGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59} {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!