ID: 1185394540_1185394545

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185394540 1185394545
Species Human (GRCh38) Human (GRCh38)
Location 22:50579966-50579988 22:50579980-50580002
Sequence CCACATACCTGCTGTTCTTGAGT TTCTTGAGTGGGGTAGTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 173} {0: 1, 1: 0, 2: 0, 3: 14, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!