ID: 1185420083_1185420094

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1185420083 1185420094
Species Human (GRCh38) Human (GRCh38)
Location 22:50730357-50730379 22:50730388-50730410
Sequence CCCGGGTATCTGTGGATCCCGCC AGCCGGTGTCGGAGGCTGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!