ID: 1185422805_1185422814

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1185422805 1185422814
Species Human (GRCh38) Human (GRCh38)
Location 22:50744487-50744509 22:50744527-50744549
Sequence CCAAATGAAGCCCCTGACACCCC CCACTTGTGTTTACAGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 157} {0: 1, 1: 1, 2: 2, 3: 15, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!