ID: 1185422812_1185422814

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1185422812 1185422814
Species Human (GRCh38) Human (GRCh38)
Location 22:50744509-50744531 22:50744527-50744549
Sequence CCTCAAACTTTACTACAACCACT CCACTTGTGTTTACAGCAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 194} {0: 1, 1: 1, 2: 2, 3: 15, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!