ID: 1185422845_1185422851

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185422845 1185422851
Species Human (GRCh38) Human (GRCh38)
Location 22:50744699-50744721 22:50744713-50744735
Sequence CCTATGTGGTCGTGGGAATCACA GGAATCACAAGCTGGGGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 80} {0: 2, 1: 0, 2: 1, 3: 15, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!