ID: 1185423374_1185423386

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1185423374 1185423386
Species Human (GRCh38) Human (GRCh38)
Location 22:50748218-50748240 22:50748268-50748290
Sequence CCAGGGACCTAGACATCTAAGGG GTGCCCACTTAGACATCCGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 83} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!