ID: 1185426619_1185426633

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1185426619 1185426633
Species Human (GRCh38) Human (GRCh38)
Location 22:50775374-50775396 22:50775418-50775440
Sequence CCGCAGCATCTACTCAGTCCCAG CAGCAGGCAACAGTGGAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 49, 4: 304} {0: 2, 1: 0, 2: 4, 3: 37, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!