ID: 1185441386_1185441401

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1185441386 1185441401
Species Human (GRCh38) Human (GRCh38)
Location X:229996-230018 X:230049-230071
Sequence CCTGCTCCCTTGGGACCAGGCTG CCCATTCGGCCCCACCTGTCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 29, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!