ID: 1185441395_1185441401

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1185441395 1185441401
Species Human (GRCh38) Human (GRCh38)
Location X:230034-230056 X:230049-230071
Sequence CCTCACCTTGACCCTCCCATTCG CCCATTCGGCCCCACCTGTCAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 0, 3: 11, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!