ID: 1185464448_1185464458

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1185464448 1185464458
Species Human (GRCh38) Human (GRCh38)
Location X:346375-346397 X:346406-346428
Sequence CCAGGGCACAGGCGGGGGCAGAG CCTGCGGGAGGCGCCGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 639} {0: 1, 1: 0, 2: 5, 3: 39, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!