ID: 1185465544_1185465546

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185465544 1185465546
Species Human (GRCh38) Human (GRCh38)
Location X:352377-352399 X:352391-352413
Sequence CCGCTACGGCGACGGCCCCCAGG GCCCCCAGGCCTCCTCCCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 6, 3: 44, 4: 486}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!