ID: 1185465544_1185465556

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1185465544 1185465556
Species Human (GRCh38) Human (GRCh38)
Location X:352377-352399 X:352412-352434
Sequence CCGCTACGGCGACGGCCCCCAGG GGCTCCAGTTCACCTTTTCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 13, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!