ID: 1185467107_1185467117

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1185467107 1185467117
Species Human (GRCh38) Human (GRCh38)
Location X:361703-361725 X:361742-361764
Sequence CCAGCCGGGAGAGGACACACTGC CACACACGTACTCCACTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121} {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!