ID: 1185467122_1185467126

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1185467122 1185467126
Species Human (GRCh38) Human (GRCh38)
Location X:361766-361788 X:361780-361802
Sequence CCACCTTCACCCAGGAGGCCACA GAGGCCACACCATGCTGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 45, 4: 343} {0: 1, 1: 0, 2: 5, 3: 53, 4: 819}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!