ID: 1185470169_1185470181

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1185470169 1185470181
Species Human (GRCh38) Human (GRCh38)
Location X:377193-377215 X:377240-377262
Sequence CCACACCCAGTGGGGCCACCATG CAGGGACGGGCCGTCCACAGTGG
Strand - +
Off-target summary No data {0: 7, 1: 2, 2: 0, 3: 16, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!