ID: 1185519458_1185519467

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1185519458 1185519467
Species Human (GRCh38) Human (GRCh38)
Location X:727995-728017 X:728022-728044
Sequence CCTCCCTCTTGCGCTGCCCCTGG AGCTGGACGCTGCAAATTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 350} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!