ID: 1185585042_1185585056

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1185585042 1185585056
Species Human (GRCh38) Human (GRCh38)
Location X:1236494-1236516 X:1236545-1236567
Sequence CCCTCTGCCCTCTGGGCCCGTCT ACGGGCCATGATGACGATGGCGG
Strand - +
Off-target summary No data {0: 363, 1: 891, 2: 815, 3: 196, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!