ID: 1185585047_1185585058

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1185585047 1185585058
Species Human (GRCh38) Human (GRCh38)
Location X:1236501-1236523 X:1236553-1236575
Sequence CCCTCTGGGCCCGTCTGGGAGGT TGATGACGATGGCGGTTTTGTGG
Strand - +
Off-target summary No data {0: 67, 1: 782, 2: 384, 3: 414, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!