ID: 1185585049_1185585053

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1185585049 1185585053
Species Human (GRCh38) Human (GRCh38)
Location X:1236510-1236532 X:1236527-1236549
Sequence CCCGTCTGGGAGGTGTGCCCAAC CCCAACAGCTCATTGAGAACGGG
Strand - +
Off-target summary {0: 415, 1: 1252, 2: 539, 3: 139, 4: 141} {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!