ID: 1185596294_1185596303

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1185596294 1185596303
Species Human (GRCh38) Human (GRCh38)
Location X:1308872-1308894 X:1308913-1308935
Sequence CCACCCTGTTCATCGTCAACTAT CTGTCTCAGATCTTTACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!