ID: 1185619255_1185619262

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1185619255 1185619262
Species Human (GRCh38) Human (GRCh38)
Location X:1443373-1443395 X:1443416-1443438
Sequence CCATCATGGACACACGCCGCCAT TTGGACACACACCGCCATCTTGG
Strand - +
Off-target summary No data {0: 17, 1: 19, 2: 26, 3: 16, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!