ID: 1185619297_1185619304

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1185619297 1185619304
Species Human (GRCh38) Human (GRCh38)
Location X:1443646-1443668 X:1443689-1443711
Sequence CCATCATGGACACACACCGCCAT GTGGACACACACTGCCATCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!