ID: 1185620034_1185620041

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1185620034 1185620041
Species Human (GRCh38) Human (GRCh38)
Location X:1448400-1448422 X:1448441-1448463
Sequence CCATCTTGGACACGCCACCATCT TTGGAAAAGCACCACCATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 111} {0: 2, 1: 21, 2: 5, 3: 22, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!