ID: 1185637133_1185637138

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1185637133 1185637138
Species Human (GRCh38) Human (GRCh38)
Location X:1560970-1560992 X:1561004-1561026
Sequence CCATCCACCTCAGCATTCCAAAG TAGGTGTGAGCCACTGTGACTGG
Strand - +
Off-target summary {0: 2, 1: 77, 2: 2778, 3: 33356, 4: 94649} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!