ID: 1185747472_1185747487

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1185747472 1185747487
Species Human (GRCh38) Human (GRCh38)
Location X:2584230-2584252 X:2584275-2584297
Sequence CCCGGAGCCCCGCGCCGGCCCCG GCCCGGGACAGACGCTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 110, 4: 735} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!