ID: 1185750815_1185750824

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1185750815 1185750824
Species Human (GRCh38) Human (GRCh38)
Location X:2608868-2608890 X:2608898-2608920
Sequence CCTGGGGGGGGTGCCTGTTAGGA GGGGACAGCAAGGGCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!