ID: 1185750819_1185750826

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1185750819 1185750826
Species Human (GRCh38) Human (GRCh38)
Location X:2608881-2608903 X:2608923-2608945
Sequence CCTGTTAGGAACAGAGAGGGGAC AGGCCCACACCTCTCCAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!