ID: 1185758892_1185758901

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1185758892 1185758901
Species Human (GRCh38) Human (GRCh38)
Location X:2674109-2674131 X:2674160-2674182
Sequence CCTTCCTGCCTTTGCTCACACAT TTTAATTTCAATTGTTTTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 23, 2: 167, 3: 572, 4: 2092}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!