ID: 1185768683_1185768691

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1185768683 1185768691
Species Human (GRCh38) Human (GRCh38)
Location X:2748105-2748127 X:2748148-2748170
Sequence CCTGGCCTCAAGTGATCTGCCTG GGGATTACAGACATGAGCCACGG
Strand - +
Off-target summary No data {0: 71, 1: 2073, 2: 5012, 3: 5137, 4: 3445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!