ID: 1185791647_1185791661

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1185791647 1185791661
Species Human (GRCh38) Human (GRCh38)
Location X:2931964-2931986 X:2932011-2932033
Sequence CCCTTAGGTAAATTATGTAAACA GATTTGGAAATGGGGCCTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!