ID: 1185831625_1185831629

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1185831625 1185831629
Species Human (GRCh38) Human (GRCh38)
Location X:3308698-3308720 X:3308723-3308745
Sequence CCACCTTAGACCAGATGGACAAG AGATACTGCAGAGAAGTTTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 113} {0: 2, 1: 0, 2: 2, 3: 24, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!