ID: 1185841174_1185841179

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1185841174 1185841179
Species Human (GRCh38) Human (GRCh38)
Location X:3392703-3392725 X:3392735-3392757
Sequence CCTAGGTGCCCATCCACAATAGA GAAAATGCACATATACACCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 38, 3: 360, 4: 1683} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!