ID: 1185894151_1185894161

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1185894151 1185894161
Species Human (GRCh38) Human (GRCh38)
Location X:3843468-3843490 X:3843494-3843516
Sequence CCCGGGCGCCTTCATGGGGACGC CAGGTCCGGGGCGCCGGGCCGGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 1, 3: 6, 4: 61} {0: 4, 1: 2, 2: 4, 3: 41, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!