ID: 1186017807_1186017818

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1186017807 1186017818
Species Human (GRCh38) Human (GRCh38)
Location X:5217943-5217965 X:5217994-5218016
Sequence CCACTGTACTCCAGACTGAGCAA AGGGGTAGAGAGAAGGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 26, 3: 429, 4: 3693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!