ID: 1186107951_1186107968

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1186107951 1186107968
Species Human (GRCh38) Human (GRCh38)
Location X:6226865-6226887 X:6226915-6226937
Sequence CCTCCCTCTCCCTACCTCATCCC GCGGGTGCCAGCGCGGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 204, 4: 2065} {0: 1, 1: 0, 2: 4, 3: 27, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!