ID: 1186108324_1186108326

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1186108324 1186108326
Species Human (GRCh38) Human (GRCh38)
Location X:6228804-6228826 X:6228829-6228851
Sequence CCAAGCTAGTGGCTGAATAAGAG CTGTGCTAAGAGACAGAGAAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 101} {0: 1, 1: 1, 2: 0, 3: 38, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!