ID: 1186143524_1186143528

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1186143524 1186143528
Species Human (GRCh38) Human (GRCh38)
Location X:6602268-6602290 X:6602292-6602314
Sequence CCACAGTTCCGGGGTCATAACTC CATAACCCTTGCTATAATGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 7, 3: 18, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!