ID: 1186194720_1186194727

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1186194720 1186194727
Species Human (GRCh38) Human (GRCh38)
Location X:7098954-7098976 X:7099001-7099023
Sequence CCGGCCAGGCTGAGGAGCACATC TGGCCCAGATACCATGCCCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!